RNA interference fragment for targeting HMGB1 gene, and application of RNA interference fragment

Abstract: The invention discloses an RNA interference fragment for targeting an HMGB1 gene, and an application of the RNA interference fragment. The sequence of the RNA interference fragment is anyone of AAGUUGACUGAAGCAUCUGGG, GUUUCUUCGCAACAUCACCAA and UUAUUUCGUAUAAGCUGCAUC. The RNA interference fragment can specifically and directly target the HMGB1 gene, effectively inhibits proliferation of various tumor cells, and has no obvious influences on normal cells, so the RNA interference fragment can be applied to the preparation of tumor inhibition medicines.
Patent Number: CN106244589(A)
Public Date:
Inventor: BAO GUOQIANG; YUAN LIJUAN; HE XIANLI; LIU ZIYU; PENG SHUJIA; DONG YANMING; WANG HAO
Applicant: 4TH MILITARY MEDICAL UNIV CHINESE PLA
Application Number: CN20161619859 20160801Global Dossier
Application Date:
Priority Number: CN20161619859 20160801
International Classification: A61K31/7088; A61P35/00; C12N15/113
Cooperative Classification: C12N15/113; C12N2310/14moredefault
Assignee:
Nation: