The present invention relates to RNA interference-based methods for inhibiting the expression of the myotilin gene. Recombinant adeno-associated viruses of the invention deliver DNAs encoding microRNAs that knock down the expression of myotilin. The methods have application in the treatment of muscu...
The invention relates to construction, screening and application of GRP78 (glucose regulated protein 78) gene targeted RNA interference recombinant lentivirus vectors. With use of an RNA interference technique, aiming at different target sequences of a GRP78 gene, four lentivirus eukaryotic expressi...
Disclosed are methods and compositions for inhibiting DNA synthesis in a cell using RNA. Inhibition of DNA synthesis by RNA can be used, for example, in analytical methods, as a research tool to affect cells under study, to synchronize cell cycle in a cell culture, and to inhibit cell growth. For ex...
The invention provides a berberine affinity labeling probe and a preparation method thereof and belongs to the field of biological detection. The probe comprises four functional parts including an active group, namely, berberine, an affinity labeling group, a connection part and a reporter group. Af...
RNA interference is provided for inhibition of tumor necrosis factor α (TNFα) by silencing TNFα cell surface receptor TNF receptor-1 (TNFR1) mRNA expression, or by silencing TNFα converting enzyme (TACE/ADAM17) mRNA expression. Silencing such TNFα targets, in particular, is useful for treating ...
This invention is directed to the compositions and methods for inducing female gonad maturation in crustacean species such as shrimp, lobster or crab. In one embodiment, the composition for inducing gonad maturation comprises a dsRNA corresponding to the GIH DNA, recombinant protein of a gonad stimu...
The present invention is directed to nucleic acid molecules containing a loop sequence designed to circumvent exportin-5 mediated export, and methods using these novel molecules.
Compositions and methods for treating cardiomyopathy using RNA interference are disclosed. In particular, embodiments of the invention relate to the use of oligonucleotides for treatment of cardiomyopathy, including small interfering RNAs (siRNAs) and short hairpin RNAs (shRNAs) that silence express...
The invention relates to the technical field of biology, in particular to a human JNK1 (c-Jun N-terminal kinase) gene targeting small interfering RNA (ribonucleic acid) and application thereof. The small interfering RNA comprises a sense strand and an anti-sense strand, a nucleotide sequence of the ...
The invention belongs to the technical field of plant gene engineering and relates to a ribonucleic acid (RNA) interference vector of a cotton fiber specific arabinogalactan protein glycosyl transferase GhGalT1 gene, and a construction method and application thereof. The RNA interference vector comp...
The invention provides a photocleavage fluorescent labeling reversible terminal compound and application of the compound in DNA or RNA sequencing. Photocleavage groups are adopted as inhibition groups, and the inhibition groups are disconnected from basic groups under irradiation of a certain wavele...
The invention discloses a recombinant vector and a non-GMO gene editing plant screening method. An initial carrier in the recombinant vector is a CRISPR/Cas9 carrier which contains sgRNA gene, Cas9 gene and screening label gene and is used for plant gene editing, the recombinant vector carries a Bel...
The invention relates to the field of biotechnology and particularly discloses a method for researching helicoverpa armigera larva RNA interference efficiency. The method for researching the helicoverpa armigera larva RNA interference efficiency is established by improving a method for feeding helic...
The present invention relates to a nanoliposome for delivering a factor for inhibiting gene expression specific to a hepatic tissue. The nanoliposome comprises a compound represented by chemical formula 1, and is modified with galactose residues. The nanoliposome of the present invention increases s...
The present invention discloses target point, preparation and method for treating human ADSL deficiency. The present invention established an ADSL deficiency retrieval model in nematode through RNA interference technique, and found that the sole RNA interference with PAICS gene could increase the ex...
Methods are described for the delivery of one or more small interfering RNAs (siRNAs) to a eukaryotic cell using a bacterium. Methods are also described for using this bacterium to regulate gene expression in eukaryotic cells using RNA interference, and methods for treating cancer of cell proliferat...
RNA interference is provided for inhibition of tumor necrosis factor α (TNFα) by silencing TNFα cell surface receptor TNF receptor-1 (TNFR1) mRNA expression, or by silencing TNFα converting enzyme (TACE/ADAM17) mRNA expression. Silencing such TNFα targets, in particular, is useful for treating ...
The invention discloses a citrus tristeza virus and citrus exocortis viroid dual detection kit and application thereof, and designs a dual digital PCR quantitative detection reagent composition for citrus tristeza viruses and citrus exocortis viroids. The kit contains a virus sample RNA extraction r...
Subjects of the invention are: nucleic acid molecule, expression cassette, expression vector, eukaryotic host cell, induction method of RNA interference in eukaryotic host and use of nucleic acid molecule in therapy of diseases induced by expansion of trinucleotide CAG-type repeats. Solution relates...
The invention discloses an RNA interference fragment for targeting an HMGB1 gene, and an application of the RNA interference fragment. The sequence of the RNA interference fragment is anyone of AAGUUGACUGAAGCAUCUGGG, GUUUCUUCGCAACAUCACCAA and UUAUUUCGUAUAAGCUGCAUC. The RNA interference fragment can ...